Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10298G9
Clone ID IST10298G9
Vector VICTR76
Project tigm

Sequence tag IST10298G9BBF1
Sequence
GTTTCAGAAGAAGTTTTCCATCTGTCTCCTGAAGTTGGGTTGTTCTANCGCATCTCTTTGGTAAATCCTGCACAGTCTCA
CGAGAGGAGGGAGTGGGTGTTGGGTCCTGTCCGACTGCATTCACGCCTTCAGCTTTCTGGGACTTTGTTGCCTCCTTTAT
ACAAGGAAGCTGTTAGATTTACACACTGGATGGGAGGATGTATATATTTGCTTTTAGGACTCCTCTGTTATTTCTTGTCT
CGTGTGAATCTTTCCAGCTTGCTCTCCTCTTGCTTCTTCTGTTTGGTTGCATTNNAAATAATCTCCTGATTGAAAATTTT
ATTCTTCTGGATTTGGATTGTCTGGAAGATGTGTTTATAAGAGTCTAGACGTGTATATATGTGGCTTACACACTTTAATT
CNAAGGATAACTGCNAATAGATCAACATAACCTTTTAAAAAAAGAAAAAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 96838897..97203543 395
 
EST/CDNA Est Name
  BY591225.1 - CV303695.1 - CV308431.1 - AW552829.2 - BG074284.2 - BM124686.2 - BI793934.1 - CA586852.1 - AI661693.1 - BQ265467.1 - BG075532.2 - AI265541.1 - BQ265815.1 - BM122849.2 - AA230992.1 - AI528717.1 - BQ265377.1 - BE634719.1 - AW208860.1 - BM506027


Sequence tag IST10298G9HMF2
Sequence
GTTTCAGAAGAAGTTTTCCATCTGTCTCCTGAAGTTGGGTTGTTCTAGCTGAGGTAACTGTAATTTGGATCTTGGATGGC
TTCCAAAGGCCATGAGTTGGAGACCTGGTCTCCAGTCTGTAACTGCTCTTGGGAGGGAATAGACCCTCCAAGAGGCTGGG
CCAGGAAGAAGGATGTTAGTACAATTATCTGCATGATAATGGACCTTCCTATTCTTTCTTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20515822..20516046 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es