Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10086B11
Clone ID IST10086B11
Vector VICTR75
Project tigm

Sequence tag IST10086B11BBF1
Sequence
TCCTAAATACTGTTACAGTGATAATAATCATGACACTCTTTCTTAAAAAGCCATCATTAACTGTGTCTCCTGATGTGAGT
TTTGTTTTAATTTAAAAGTCAGAGGTTGGGGGTATCACAAAATGTAGATTAGACACCCTGAGGCAAGCGAGTGCTCCTTC
TACCTGTGTCTTATAGAAACAAAAGAAGGAAAAGACCTCTAACAGCAGCAGTGGGTGCAGTGGCAGTGAATCAGAGGTCA
AGAGTCTCTTGGAGGTGGCCTCCAAAAGGCCCATGTCCTCCAAGAGCGACTCTGCAAACACAGCTTTTATTGCTCAGTTG
CCGGTCAGGCTGACTCTAAAACAAAGCAATCAAAAGCAGCTTACTGATGTGTGTCAACTGAAAACATGGTTGGCAACCAA
ATGACCCTGACAGGGCTTTGAGTCTTAACTCTGTCGTAGGCACTGTGTTCTCTTTCTCCTCAAAGGAATCTAGTCCAGGG
ATGGCAAGGTGGCTTCTTGTTAAAGGGGCTTGCTGGCAAACCTGATGACTTAAGTTCTACACACACACACA
Sequence Type genomic DNA
Unitrap ID UNI32100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71158948..71159498 551
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]


Sequence tag IST10086B11BBR1
Sequence
AGGAAACCAGTTTGTTCCTTATTTTAGAAAGAATCAGAAAATCATATAAACTCTAGGAACATGGAAAGTTTTTAATACAG
AAAGCTAGAATATGGAGTTTTAACTTGATTCTGCCCTAAGATTATTTAAGTGCAGAATAAAGTGAGTTTTTTGTTTTGTT
TATTTGGGAGGGGGTGTTTTTGTTTTAATTTAAAGAAAAGCAAGAAGTCAGATTCATCTGTGAAGGACTCCAGTGGTTCA
AACTGAGTTTTGCTTTGGCCAGATCAGTCGTAAGGACAAGGTCTCTCTGGGTTGTGCTAGCAGAGAGTTACGGTGATGTG
AATGGTACCTACCAGGTTCTCTTCACACAGTTCTCTGAACTGGTAGAATTTCTGCGCCATGAGAAGTTGGGCACTGCCCA
CCGCGGTTCGGATTTTCCCTAGAACTGAAAAGAGCAGACACAGGCGTTTACACGATGCTTCATTGTTGAGACTTTGTCTG
GTAAATGCAGCAAGAAGTTATGCTGTCATGGTTTGGGGAAAAAAAAACCAAAAAACAAAACCCCCGGCCCCACACAGCAT
GGCCACGCCCATCCGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71158377..71158951 565
 
EST/CDNA Est Name
  CF745979.1 - AW492511.1


Sequence tag IST10086B11HMF1
Sequence
TCCTAAATACTGTTACAGTGATAATAATCATGACACTCTTTCTTAAAAAGCCATCATTAACTGTGTCTCCTGATGTGAGT
TTTGTTTTAATTTAAAAGTCAGAGGTTGGGGGTATCACAAAATGTAGATTAGACACCCTGAGGCAAGCGAGTGCTCCTTC
TACCTGTGTCTTATAGAAACAAAAGAAGGAAAAGACCTCTAACAGCAGCAGTGGGTGCAGTGGCAGTGAATCAGAGGTCA
AGAGTCTCTTGGAGGTGGCCTCCAAAAGGCCCATGTCCTCCAAGAGCGACTCTGCAAACACAGCTTTTATTGCTCAGTTG
CCGGTCAGGCTGACTCTAAAACAAAGCAATCAAAAGCAGCTTACTGATGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI32100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71158948..71159322 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es