Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10910B5
Clone ID IST10910B5
Vector VICTR76
Project tigm

Sequence tag IST10910B5HMR1
Sequence
CTCCGATCGAATCGGATTCGATTCTGTGATCTGCAAGATCGCCGTGGTGCATGGGCCCCAGGCTCTGGAGAAAGGGAGCT
CTGAGCGCCACCATGTGCACCTGCTGGAGTTTAACAACAAAGGATGGCTCTAGAGACAGGAGAGGAGTTGGACACAGTAN
TANCCTTGTGGGTGGAGGGTGGAGTGAACAGCCCGAGTGGAAATCTGTGGGCCGGGCCGGCAGAAGGAAACCAAGGCTTG
TAGTTCACTAGCTTCTTGGAGGATGAGCTCTCACCTGAGTCTTACCTTTGAAAGAAATCCAGTGATTCTTACTNAGCCAG
ATTCNCTTGTCCTCN
Sequence Type genomic DNA
Unitrap ID UNI30139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154439661..154439994 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es