Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11675C5
Clone ID IST11675C5
Vector VICTR76
Project tigm

Sequence tag IST11675C5HMF1
Sequence
CCCCGGCAATGAAAACACAACAACACAATTAATATGAATACATGCTGTGCGCCTAGATTGGGCAGATCTACCACTACACT
ACCATCTTCCACATCTTATGAGACCCCTTANAACTTGCCATTTCTCCAGGCTATGTGCTTCTGCTCTGCTTTTTTTCTTC
TTCTTCCTCCTCCTCCCCTGAGTTGCCTCTCTCAAATCTCCTTCTCCCCACCACCCCTTTCCCCTCCACCTTCCCTTTAT
TTGCCCAATCATCAGCTCTCCTTTATTTTACAAATTAAGGTGGGGAGCAGCTTTACAGGAAATCACCTGAGTGCTGACTC
ATTCCTTGTTCGAAGTCACTCTTAGAGCAGAATTAACATCAAATATAATTAGCTCCAGTGCTATCCACAACACCCTGGAC
TCTTCCTCTGTTGGCAGTCAGTCCACATGAGTGCTTTTCTGACTCCCCACCCCCACCCCGCCCCCATAGTCTGGCAGANG
CAGGCTTGGGCCATGTAGTGTTAGAAGANGGANCANCNNTATTNGCTGGCTTN
Sequence Type genomic DNA
Unitrap ID UNI32103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15158004..15158535 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073455 (9030025P20Rik) NP_001116844 RIKEN cDNA 9030025P20 gene Gene [Source:MGI Symbol;Acc:MGI:3583895]


Sequence tag IST11675C5BBF1
Sequence
CCCCGGCAATGAAAACACAACAACACAATTAATATGAATACATGCTGTGCGCCTAGATTGGGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15126637..15126705 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es