Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11272D10
Clone ID IST11272D10
Vector VICTR76
Project tigm

Sequence tag IST11272D10HMR1
Sequence
ATGTAAAGAAAGGGTTCTCGACAAAGGAAGTTCAGCTCCAGGGACGGCGCTTGCCCTCC
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203915..65203973 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


Sequence tag IST11272D10HMF1
Sequence
ACATTTCCTTANCAAACTTTCTGAGCGCTCCCTGTGACCGGTACTACAGGAAGTACCATGCAATGGCCTGACCAGAAACG
CANAGGGGCAGGCACCCTAAGCCAGGCTTGCTTAGCGGGGCTGGCACCTACCTTGNAAGGGTGCCCACTTTTCACACCAC
CCAAGGACTCACCCACCTCACTCTTCCACTGTTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203726..65203918 187
NO GENE  

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es