Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P022E05
Clone ID P022E05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P022E05
Sequence
CCTTCTCGCCCTGTGCGCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGGAACCTACACCCTCG
Sequence Type mRNA
Unitrap ID UNI11542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19735167..19735241 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040824 (Snrpd2) NM_026943 small nuclear ribonucleoprotein D2 Gene [Source:MGI (curated);Acc:Snrpd2-001]

 
Come back to gene ENSMUSG00000040824


For any suggestions or comments, please send an email to unitrap@crg.es