Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14170D2
Clone ID IST14170D2
Vector VICTR74
Project tigm

Sequence tag IST14170D2BBF1
Sequence
TTACAATCCNNTCNCANAATCTACAACACAAATGGGTGCTCCGGCTCAATAAAACANAATCTGCATGTGCCAAAAGCAAN
AANCAAGGANGCTCTGAACTAANCAAGGAGGCTCTGAGCTAANCAAGGAGGCTCTGANCTAANCAAGGAGGCTCTGANCT
AANCATGGAGGCTCTGAGCTAANCAAGGAGGCTCTGANCTGGTCCAGGGGGAGGAGGGAGAACACNTGATCTCCAAGGGC
ATTCTCTGGANANCATACCTGAAGCAAAGCAACAAGCCAATCTGGANGGTGATTTTGTTTGANTTGTGCTCATGGGTTTC
NNGANNCTGTAACATCTCCACTTTACAGCACATCNGGNTCTGCACTATCACTCACTGGTCCNCATGTGTTCGGNTACTTN
NTTNNAACATCACGGACCTCCNATCTTCNNAACTTACAGTGNTNCAANTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14170D2HMF1
Sequence
TTACAATCCAGTCTCAGAATCTACAACACAAATGGGTGCTCCGGCTCAGTAAAACAGAATCTGCATGTGCCAAAAGCAAG
AAGCAAGGAGGCTCTGANCTAAGCAAGGAGGCTCTGANCTAAGCAAGGAGGCTCTGANCTAAGCAAGGAGGCTCTGANCT
AAGCATGGAGGCTCTGANCTAAGCAAGGAGGCTCTGANCTGGTCCAGGGGGAGGAGGGAGAACACNTGATCTCCAAGGGC
ATTCTCTGGANAGCATACCTGAAGCAAAGCAACAAGCCAATCTGGANGGTGATTTTGTTTGAGTTGTGCTCATGGGTTTC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57296052..57296370 301
 
EST/CDNA Est Name
  BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1


Sequence tag IST14170D2HMR1
Sequence
TCTTCCTGCNNACTCANGTCTCCAACATACCCTAGGTGTCTCCCTTGCTTATAGTCCCACGAAGACTGTCTTTTTTTTTT
TTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57295964..57296051 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es