Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11733A6
Clone ID IST11733A6
Vector VICTR76
Project tigm

Sequence tag IST11733A6HMF1
Sequence
GTACCACACAGTCAAATGCAAAGCAAGAATATAGCTTTAAGTTACTGTGAATGACAGTCTACAGCTGAAAGTCATGCTTC
CCCCTAGAAGATGTTCTTGACCATGACACTGACCACACCTCGGCAGTACATATATGCCCATATTCTACTACCCCAACCTA
TAAATGTTACTTTACACTGGAAGGAGGAATTAAGGGTATGATGGAAATGAAGTTGCTAATTAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84780883..84781107 225
NO GENE  


Sequence tag IST11733A6BBF1
Sequence
AAGAGATGACAGGAAGGACAAAATACCTAAAGCCGGGGATCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100238371..100238418 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es