Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980E1
Clone ID IST14980E1
Vector VICTR76
Project tigm

Sequence tag IST14980E1HMF1
Sequence
GTCATTGTGTCTGACAGATCTGCTAAACTGGTCTTATTTTCAGTGACTCAATGAGAAGTTGCTTTCCCTGGACAGTTCAT
CTTTAAACAAGCACACCCAAACATCTCAGGGCGGACGGACCAACATTCCTTCCAGAAGCATTCCAGAATTTCTTTACATT
ACAATGACTGAATTTGCATTCACCTCCGGTAGACAATGGACACATAAATATGCAAATACCCATTTAACCGTTCCTATCCG
GCAGTGTTAAAGAGCCTCCAACTTCCCCCATCCCTTACCGGAATATCTAACCCATAACAAGGCATTGGGTAAACAGGATT
CGGGGTTGGGAGGAATAGGGGTCCCTTCTCCGGCGGCAGAAATCCCCTCCGCCGAAGTTCAGANCTGGGTCCACACCATA
CGCCGCTAAGAAAAAAGACACTCACTGTGAGCGCCCAGAAGTANGGAGTACCCTCGGCGGANGGGTCCCCACTGTGAGCA
CTTCTGAGCNTGGATCNNCTCTGNTTCNATGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443743..180444255 493
 
EST/CDNA Est Name
  CA327345.1 - BI653462.1 - CF167818.1 - CD538654.1 - AI549786.1 - AA427046.1


Sequence tag IST14980E1HMR1
Sequence
TGACCNNGTGGCAGTCTCTTAACTCCATAGCTCTACCCGAAGCTATCCAGGTTGGTATCGACAAACTTTGTAGCACTTAC
TTTAACTCTGGGTAAAGTTGGATTATCAACTCAAACTTGTGCAAGGGAAGAGGCTGGTATCATGAGGAGAGAAGAGGGTT
C
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443586..180443738 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es