Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13824H9
Clone ID IST13824H9
Vector VICTR74
Project tigm

Sequence tag IST13824H9HMF2
Sequence
CTCCTACACCATGCTCTGAACGAAGGCCCCAGGGTGAATCACACAGCCTCAAAAAGCCCAAAGCACCCCACAGTGTACAT
AGCCAGGACAGAGTTCTGAGCCTGGGCCCAGCCCGCCTGANCTGTTGGCTAGGGTCAGTGGCTCTAGGTGCCCTGGGGGG
CGGGGGTGTCTCTTGATGGTANTCTTCATCAGGTANAGATGGAACCTTTCTCTATAAAACAAGCTGCCCTTGAACTCCTG
ATAATTCTCCTGCCTCAGCTTCATCGACTTCACCAAATTCNCCCTGANACTTTGAAAAANAANTTGCGTTTNATTTNAAG
GGTGTGTATGTACCTACACACAGCTNCNCNTNNCACATGTGTGGAAGTCCNNTCCTTCTACCNCNTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13824H9BBF1
Sequence
ATTTATTTATTATATGTAAGTACACTGTAGCTGTCCTCAGACACTCCANAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI7029 UNI21808 UNI25026 UNI31104 UNI32106 UNI32107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166455: 6992..7057 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 16789120..16789185 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4058642..4058707 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15751028..15751093 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3941196..3941261 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16379949..16380014 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 79792440..79792505 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 50422868..50422933 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5662925..5662990 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083844 (AL627069.10)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 32770928..32770993 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19107808..19107873 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021772 (Nkiras1) NM_023526 NFKB inhibitor interacting Ras-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1916971]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12698423..12698488 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 9523455..9523520 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5378973..5379038 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042607 (Asb4) NM_023048 ankyrin repeat and SOCS box-containing 4 Gene [Source:MGI (curated);Acc:Asb4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3375613..3375678 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15598055..15598120 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040118 (Cacna2d1) NM_009784 calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11087214..11087279 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028211 (Trp53inp1) NM_021897 transformation related protein 53 inducible nuclear protein 1 Gene [Source:MGI (curated);Acc:Trp53inp1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 62751720..62751785 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7815557..7815622 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29792081..29792146 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019715 (Gle1) NM_028923 GLE1 RNA export mediator (yeast) Gene [Source:MGI (curated);Acc:Gle1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 39588656..39588721 64
NO GENE  

 
Come back to gene ENSMUSG00000019715


For any suggestions or comments, please send an email to unitrap@crg.es