Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14433D10
Clone ID IST14433D10
Vector VICTR74
Project tigm

Sequence tag IST14433D10HMR1
Sequence
TTACNNCCTGGGAACTGCCAAAGCAACACAGTGTCTGAGAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCAGGAGGAGG
TCCAAATACAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGANAGTGCTCTGAGCACTGAAACTCAGAGG
AGAGAATCTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGANCANTCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI14866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114577..114807 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48106..48336 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12577823..12578053 221
 
EST/CDNA Est Name
  AA168445.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031768..3031998 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14900482..14900712 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11860630..11860860 221
 
EST/CDNA Est Name
  BY147827.1 - BY793765.1 - BB843709.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3871214..3871444 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110204..3110434 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9634059..9634289 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826469..7826699 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4183069..4183299 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3288369..3288599 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079407 (AC186757.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D9B9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255609..5255839 221
 
EST/CDNA Est Name
  AA088077.1 - CB272803.1 - AA066383.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912877..3913107 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3770461..3770691 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110466..5110696 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987268..3987498 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252518..12252748 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054924..5055154 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906368..4906598 221
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761762..6761992 221
 
EST/CDNA Est Name
  BY780300.1 - BY792977.1 - BY145030.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551138..4551368 221
NO GENE  

 
Come back to gene BY780300.1 - BY792977.1 - BY145030.1


For any suggestions or comments, please send an email to unitrap@crg.es