Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0094
Clone ID CC0094
Vector pGT0lxfT2
Project sanger

Sequence tag CC0094
Sequence
CCTGTCCCGTTACCGCCTCCTAGCCGGCCTCGCGCCTTTCGCCGGCACCTTGCGTCGACTGCGCAGCCGGGCCCGCTCCT
TGCCACGCGCGCCCCCAGGGGCCCCGGCTCCGGCGCCGGCAAGGGTCGCGTCCCGCTTACCTGTTCCTCAGGTAGCCAGC
CATCCGCCGCCATGGGTGCCTACCTCTCTCAGCCCAACACGGTGAAGTGCTCCGGGGACGGGGTTGGCGCCCCGCGGCTC
CCGCTGCCCTACGGCTTCTCCGCCATGCAAGGCTGGCGCGTCTCCATGGAG
Sequence Type mRNA
Unitrap ID UNI1578

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31522676..31522966 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029147 (Ppm1g) NM_008014 protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform Gene [Source:MGI Symbol;Acc:MGI:106065]

 
Come back to gene ENSMUSG00000029147


For any suggestions or comments, please send an email to unitrap@crg.es