Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12509C5
Clone ID IST12509C5
Vector VICTR76
Project tigm

Sequence tag IST12509C5HMF1
Sequence
ACCCCCTCTGGGGCGCACCCCCGCTCCTTTATTTATTTTTTTGCACGGATCCCCCGGNCGGCNCTGCTTANCACANGCCC
GGNAGGTGAAAGGGGNAAGGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12509C5BBF1
Sequence
ACCCCCTCTGGGGCGCACCCCCGCTCCTTTATTTATTTTTTTGCACGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168591528..168591578 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es