Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14271A7
Clone ID IST14271A7
Vector VICTR74
Project tigm

Sequence tag IST14271A7HMR1
Sequence
ATTCATGTCTAGAATAAGTTTCAGTCCTGGCCCCAAGAGAGGTCTAAAGACATCTTGAGCCTCTTTTTCTTTCCTGACTT
GCTGTTTGGTCTCCACCAAGACAGGCACGTGGGAGTTTCCTTTCCACACACTGAAAGTCCCTTGAGTTAAATAGAAATTC
AGTTTACAATCCTCTGTCAAGTAACACTAACAATTATTTCTGCTAAGTGACCNNTTC
Sequence Type genomic DNA
Unitrap ID UNI15792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108395191..108395402 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029270 (2900024C23Rik) NM_026062 RIKEN cDNA 2900024C23 gene Gene [Source:MGI Symbol;Acc:MGI:1914516]


Sequence tag IST14271A7BBF1
Sequence
GAATGACTCAGCAATTGCTACGGAATTCCTGTTACTTTCAAAATCTCTGGCAGTTCATGTCAGATAGCTCACAACAACCT
GTAACTCACGCTCAGGGGGAAGGGACCTGGCTTCCTTANGCATCCATGCCTGCATGCATACACATACACATATAAGGTTG
ATTAAAAATTAAAAATATACATATATAAAAATATTTTTTAAATTGTGTATGTTTNNAGGGAGGGTGTGTAANGNNAANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108395399..108395629 225
 
EST/CDNA Est Name
  BF722029.1 - BY318218.1 - BY131147.1 - BY006163.1


Sequence tag IST14271A7HMF1
Sequence
NAATGACTCAGCAATTGCTACGGAATTCCTGTTACTTTCAAAATCTCTGGCAGTTCATGTCAGATAGCTCACAACAACCT
GTAACTCACGCTCAGGGGGAAGGGACCTGGCTTCCTTAGGCATCCATGCCTGCATGCATACACATACACATATAAGGTTG
ATTAAAAATTAAAAATATACATATATAAAAATATTTTTTAAATTGTGTATGTTTTCAGGGAGGGTGTGTAANGTGAANCC
NAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108395400..108395638 235
 
EST/CDNA Est Name
  BY066487.1 - BY043920.1 - BY294048.1 - BF722029.1 - BY318218.1 - BY131147.1 - BY006163.1

 
Come back to gene BY066487.1 - BY043920.1 - BY294048.1 - BF722029.1 - BY318218.1 - BY131147.1 - BY006163.1


For any suggestions or comments, please send an email to unitrap@crg.es