Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12797C8
Clone ID IST12797C8
Vector VICTR76
Project tigm

Sequence tag IST12797C8HMF1
Sequence
CTCTGTATAANAACAAGTATTAATTGCGGAACTATCTCTCCAGCCCCCTTGCTC
Sequence Type genomic DNA
Unitrap ID UNI32116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31612118..31612171 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006527 (Sfmbt1) NM_019460 Scm-like with four mbt domains 1 Gene [Source:MGI (curated);Acc:Sfmbt1-001]


Sequence tag IST12797C8BBF1
Sequence
GTCTGATTTTAGTTTTCCCAGACAGGGTCTCTCTTGTGTAGCCCAGGCTGTCCTGGAACTGTGTAGACCAGGTTAGTCTG
GAACTCATAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122719077..122719171 95
NO GENE  

 
Come back to gene ENSMUSG00000006527


For any suggestions or comments, please send an email to unitrap@crg.es