Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046A8
Clone ID IST10046A8
Vector VICTR75
Project tigm

Sequence tag IST10046A8BBF1
Sequence
TGATGACCTTCTCTGTAAATGCCCAGCCAGTGGGGAGTGATCAGGAGAGTGGGCCAAAGCTGATTAAAGAGCCATCCAGG
CCTCAGATATGCTGTTAAAATAGAAGTCAAGAGCAGCGGGACACATTCAGGAGGCAGGAGCAGGTAGGTCTTTGTGAGTT
CAAAGCCAGCCTGGTCTACACAGTGAGTTCTAAGCCAGCCAGAGATATGTAGAGGCAAAGAAAGAAAAGAAAGTGCTAAG
AATACCACAGGCCTGAGTAGAGTTGGTTCCTTAGTTCTGCGGCAGGTTAATCCACCCACCTCAAACCTCACATCCTCCAA
CTCAGTTCGCTGGTTCCCCCCATCCTTCTGCAGGAACACCCTACTCCTAAGATTTGCTTACAAGACACTTGCTTTGTTGT
GCAAAATGGATAACAAAGTACGGAGCGGAGGTTCATGGGGCAGGTGGTATAGGAAGCCACAAGTCAAGGGTGTGGTGCTG
GCACCTCGCTGTGCTTGTCCAAGGTTGAACTCAAGGCCCAGTTGTGCCCCTTTCAGGCTTCG
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118772420..118772962 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]


Sequence tag IST10046A8HMR1
Sequence
ATCNAAATTTGCCTGACTCCACGCCTCTGGTGCATAGTCCGAGAGACAGGTAAGCGGAAACTTGAACTAACTCTGCACCA
CTCAGGAGCCCTGCTTGGAGTCTCCCTCAATGCAGCCCTTGGGGGAAGTTNNNNCTTANCNNCCNGNGNNNNGACGGNGG
AAGCAGCGCAGGTTCATTTGTGTCAAGACCATGTGTTTCCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es