Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10858A11
Clone ID IST10858A11
Vector VICTR76
Project tigm

Sequence tag IST10858A11HMF1
Sequence
ACAGCAAGCCCCGCCCCTAGGCCCTGGTCCAACTCANCCCCACGAGTCGCGCCCTCGCCCCCACTTCTCGCGAGAAGTGA
ACACGCCTGGCCGGACGGGAGGAAAGTATCTGCTCCGCTGAGGGGGGAAAGGAGGAGCAGGAGACAGATTGTGGGACCGA
GCGCGGGCGGGCGGGAGGCGCCGGAGCTACCAGCGGGTGAGTCCTGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI8391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102455778..102455988 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052414 (AC137156.3-201) NM_146065 Cyclic AMP-dependent transcription factor ATF-7 (Activating transcription factor 7)(Transcription factor ATF-A) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0S1]

 
Come back to gene ENSMUSG00000052414


For any suggestions or comments, please send an email to unitrap@crg.es