Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P068B11
Clone ID P068B11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P068B11
Sequence
ACCGGCCACCGCCACCAGCGCAGCTGTGCCACAGCCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGT
GTCCTCG
Sequence Type mRNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 65887189..65887271 83
 
EST/CDNA Est Name
  AK169767.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062574..30062656 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es