Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13871D12
Clone ID IST13871D12
Vector VICTR74
Project tigm

Sequence tag IST13871D12BBF2
Sequence
GTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAGTGAGATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI32124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117242893..117242955 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44438530..44438592 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]


Sequence tag IST13871D12HMF1
Sequence
GTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTANTGAGATCTGATGCCCTCTTCTGGTGCATC
TGAAGACAGCTACAGTGTACTTAGATATAATAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27174419..27174568 144
NO GENE  

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es