Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P068C01
Clone ID P068C01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P068C01
Sequence
CTCAACTGCCACACCAAGATCCGCCACGTGGATGCTCACGCAACTCTGAATGACGGGGTGGTGGTCCAAGTGATGGGGCT
ACTGTCCAACAACAACCAGGCTCTGCGGAGGTTCATGCAGACCTTTGTCCTTGCTCCTGAGGGCTCTGTTGCCAACAAAT
TCTATGTTCACAACGACATCTTCAGGTACCAAGATGAGGTCTTCGGTGGCTTTGTCACAGAGCCTCAAGAGGAATCCGAG
GAAGAAGTAGAAGAACCTGAAGAAAGACAGCAGACACCAGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAGAC
TGTCAG
Sequence Type mRNA
Unitrap ID UNI11560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55302556..55307043 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es