Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14307B3
Clone ID IST14307B3
Vector VICTR74
Project tigm

Sequence tag IST14307B3BBF1
Sequence
CACTCACTCACTCACTCACTCACTCACTCACTCACTCACTCTTA
Sequence Type genomic DNA
Unitrap ID UNI30728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17850050..17850092 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041297 (Cdc2l5) NM_001081058 cell division cycle 2-like 5 (cholinesterase-related cell division controller) Gene [Source:MGI Symbol;Acc:MGI:1916812]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47784572..47784614 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101195971..101196013 43
NO GENE  

 
Come back to gene ENSMUSG00000041297


For any suggestions or comments, please send an email to unitrap@crg.es