Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P068B06
Clone ID P068B06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P068B06
Sequence
TGAACGAGTGCGCAGTGCCATGAAGGCCTCGGGCACG
Sequence Type mRNA
Unitrap ID UNI11562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97395179..97395215 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081051 (AC102483.8)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73421258..73421294 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045128 (Rpl18a) NM_029751 ribosomal protein L18A Gene [Source:MGI Symbol;Acc:MGI:1924058]

 
Come back to gene ENSMUSG00000045128


For any suggestions or comments, please send an email to unitrap@crg.es