Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15005G3
Clone ID IST15005G3
Vector VICTR78
Project tigm

Sequence tag IST15005G3HMR1
Sequence
GGTAACTCANCACGTGGCACCCACGTGTAGGAAGCAGANAGCAATGAGTGCTGGTACTAAGCTTGGGGTGTTTTTCTTTA
GTCTAGAACTCCACCCCGTGGAAATGATGTCTCCCGCGTTTAGGATGGGCTTTCCTACCTCAGCTACCCTAATCTAGAAA
ATACTTCACTGACAGGTCCAAAGGCTTGTCTCTAGGGTGATTTTANATCTTGTGGATAATCGGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI9266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120942616..120942842 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048402 (Gli2) NM_001081125 GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

 
Come back to gene ENSMUSG00000048402


For any suggestions or comments, please send an email to unitrap@crg.es