Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12563E3
Clone ID IST12563E3
Vector VICTR76
Project tigm

Sequence tag IST12563E3BBF1
Sequence
CAGGCTTTCGCCTATCATCTGTTTGCATGTGTGAATCTGTGTGTGTGTGTGTGTGTGTGTGNGTGTGTGTGTGTGTGTGT
GTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745494..7745581 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]


Sequence tag IST12563E3HMF1
Sequence
CAGGCTTTCNCCTATNATCTGTTTGCATGTGTGAATCTGTGTGTGTGTGTGTGTGTGTNTGTGTGTGTGTGTGTGTGTNN
NTN
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7745504..7745581 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]

 
Come back to gene ENSMUSG00000039201


For any suggestions or comments, please send an email to unitrap@crg.es