Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14603F4
Clone ID IST14603F4
Vector VICTR74
Project tigm

Sequence tag IST14603F4HMF1
Sequence
TTAATNNCCTGCCCCACCGGGGCTAAAAGGAATTCTGAGAACATTCAAGAACCCTGGATCAGAAGTTAAGAACACCTACT
GCTCTTTCAGAGGACCAGGGTCTGANNNNCAGCAATCNAATGGCGACTTACAGAGCTCTATAACTCTANTCCAGTGACCT
CTTCTGGCCTCCCGAGACACCAGGTACATATATGCTGCCTATATACACCTGCAGGCAAGACACCCGTACTCATAAAACAA
GAAAACACATTTTTAAAAAGACCCCTGCAAGACAGATGTGACGTGGCAAGTGCCTTTAATCCTAGCATTCAGGGGTGGAA
ACGGAAGGGTCNATCTGAGTTCAAGGTCGTCTTTGGCTACTTAANANTTTGAAACCNTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI32127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136449181..136449561 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]


Sequence tag IST14603F4HMR1
Sequence
ATTAGGAGCTGTGAAGCCTTTGTTCTTATTGGCAAAAGGGTCCCATATTCTTTCCCTTATACTTGTTGCCATATTAAATG
GGTAATGTTTATAAAAGGTTTCCCCAGTGTCTGGCCCGCTCTAATGTGCTTAGCTATTGCTATGACTGCCCCCGTCTGAC
CTCCAANACAAGAGCCAGATCTCATTCAATAGTTGTACGTGGCATATGATGTTCANAAAATGTTTGTTGATGGGCTGAGT
GAAATTGTGGCTATGAAGTCATANAATGAAACAGAGGGGTCTCAGGAAGTANTCAATGAGTTGGCTCANCAGGTAAAGGT
GACTGCTGCCAAGTCTGATGACCTAAGTTCAATTCCTGGGACCCAAATGTCANAAGGCAAAACACTCTTGCAAGTTGCCC
TGTGACTGTCACTTGTGCATGCNTGCACACACATAANNAAATNNNTGCNNTATTAANAATNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136449558..136450017 430
 
EST/CDNA Est Name
  CF581044.1 - BI439354.1


Sequence tag IST14603F4BBF1
Sequence
TTAATCACCTGCCCCACCGGGGCTAAAAGGAATTCTGAGAACATTCAAGAACCCTGGATCAGAAGTTAAGAACACCTACT
GCTCTTTCAGAGGACCAGGGTCTGATTCCCAGCAATCAAATGGCGACTTACAGAGCTCTATAACTCTAGTCCAGTGACCT
CTTCTGGCCTCCCGAGACACCAGGTACATATATGCTGCCTATATACACCTGCAGGCAAGACACCCGTACTCATAAAACAA
GAAAACACATTTTTAAAAAGACCCCTGCAAGACAGATGTGACGTGGCAAGTGCCTTTAATCCTAGCATTCAGGGGTGGAA
ACGGAAGGGTCGATCTGAGTTCAAGGTCNTCTTTGGCTACTTAAAAATTTGAAACCATCTCTCANAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI32127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136449171..136449561 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es