Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15053H3
Clone ID IST15053H3
Vector VICTR80
Project tigm

Sequence tag IST15053H3HMR1
Sequence
TAAGTAGCTATAAGTTTACTTGGGTATTNNTAATAAGTGCTATTTTGGAGGAAACTAGGAATTTAAGTATCAGTCTTCTC
TCTTCTGTTCATAAAAATGCCTTGCTAGCCAGAGATAGTAGATGTATAAGGTATATATGCTCCAAATCTCTGTGCTGTAG
CACCCTCAAAATAGGTGGACTGAGAAGTCAAGGGTTGCTATAAGCACTTGTTGCTCTTGGAGAGAACCCAGATCAACTCC
CAGCCACTACCACGTGGTAGGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108457106..108457371 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]


Sequence tag IST15053H3BBF1
Sequence
CAAAGTCAAACTAAAGTCCAGATCCATCCCCAGCAGCAGCTCTTCATGTTTCTCTGAGGAGACGATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154162952..154163022 71
NO GENE  

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es