Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0034
Clone ID CC0034
Vector pGT0lxfT2
Project sanger

Sequence tag CC0034
Sequence
CGCCCCTCCCCCACAACGCCCGCCTAGCATGGTGCGGCGGCCGCGCGCGCCGACATGGGCGAGAAGCTGGAGCTGAGGCT
CAAGTCGCCTGTGGGCGCCGAGCCCGCCGTCTACCCGTGGCCGCTGCCGGTCTAC
Sequence Type mRNA
Unitrap ID UNI1589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80218136..80218269 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]

 
Come back to gene ENSMUSG00000061589


For any suggestions or comments, please send an email to unitrap@crg.es