Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14576C10
Clone ID IST14576C10
Vector VICTR74
Project tigm

Sequence tag IST14576C10HMF1
Sequence
GGGGTTCCACGGCCACCCTCTGCTCTGCCTGCTTCTGACCTCAGGCTCAGAGGTATGAGCTGAGTGGGCGCAGCCTGTGC
AGGATGGGGCAGGCACTGGGGTGGGTGGCAGCTTCTCACCTCTGTAGTTTCATTGGCTCTGGAGAGCAGGGTGGGGACAG
AGGTGCTCCAGAGAAGCTTTCCATCTTCCTGGGTGTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI23136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113278755..113278956 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]


Sequence tag IST14576C10HMR1
Sequence
CCCACCCCCGCCCCCCATCCCTGANGCTGCCTGCAACCCTTCTGGGAAGCATTTCAACCTCTTACCAGCAAGATCTGCCC
TGGTTGCCATGGTTACAGTANAACCNCTCACCCACCCACCCACCAAGGCCTCCCAGGACAGGATCCCCAGGTACAACTCC
CCATGCCCAGTACTCACAGTATAGCCAGGCGAGTCCCCAGGGCATGGTGGTGCACTGGGTGCCCCCTGAGAGCAGAGGCA
CTGTCCCCAGAAGTGTGTCCAGAGGCCTGAGCCAGGGACTACATGGCCTTAGGTCNNCNNAGGTGGCCANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113278954..113279262 295
 
EST/CDNA Est Name
  BB868472.1 - BY257475.1 - BY245368.1 - BF323232.1 - BY261790.1 - BY271651.1 - BY237288.1 - BY274422.1 - BB632619.1 - CJ083361.1 - BF582396.1 - BI739257.1 - BE570096.1 - BY249115.1 - BY243898.1 - BY247619.1 - BX525560.1 - BI739251.1 - BM730332.1 - BI101509

 
Come back to gene BB868472.1 - BY257475.1 - BY245368.1 - BF323232.1 - BY261790.1 - BY271651.1 - BY237288.1 - BY274422.1 - BB632619.1 - CJ083361.1 - BF582396.1 - BI739257.1 - BE570096.1 - BY249115.1 - BY243898.1 - BY247619.1 - BX525560.1 - BI739251.1 - BM730332.1 - BI101509


For any suggestions or comments, please send an email to unitrap@crg.es