Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P067E02
Clone ID P067E02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P067E02
Sequence
AGTAGGTCGGCTTCCGGGGACGGTGATGGGAATGGCGGCTCTCGGAGGCCCCATGTGTACCGTGGTGGGATTGAGGGACC
GGGCGGATCCACACTGCGTTTTCGGTCACGGCGAGAGGACTCAGGCTATCTGGGCAGACGTCCCGAGTCTGCAGTCACCG
GCTTCCCGTCTTGTTCCGCCGCTCGCCCAGGAGATTCTTCTCCAGACTCTGATGCGGAAGGCCAGTGTCGCGCCTCTTAG
GAACATGACCCTTCGTTGCGCGTGTCCAGGGTCGCGGCGTAGAACCGGACGGGTGGCTCTCTTTGCAGCTCGCGGAGGCG
AACCGGGCGGCAG
Sequence Type mRNA
Unitrap ID UNI11567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86239413..86239675 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es