Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15000C2
Clone ID IST15000C2
Vector VICTR78
Project tigm

Sequence tag IST15000C2HMR1
Sequence
AAACTTCAAAGCTTGCCCCCGTATGACACACTTCCTCCACCACCAAAGCAGCATCCACTTCTACAAGGCCACCGCTCATA
ATCTTACCACTCAATCCCCATGAGCCTCTGGGGGCCATTTTCTTCCAAACCACACACTGCTATTANATTACTTTTCAGTT
AGTATCTCTCGCTGTAAGTTAGTATCCTTTTCTTCCTGCATCCTTAGTCATCCCTTCTCCTGATCCCCAGGACTCTCCTT
ATTTGGCCCCGATGTTCTTTCTGTCCCCTTTCTACCGTTCTCCCATGTATTCATGGTGCCTGGATGGTTTTTANAGTCAG
TATATCTTANATCANTGGTTCCNACCCCNNAACCCTTAAAAAAATACTGGTGTCTTCTGAANACTANNACAGCTGAAAGC
CNTCCGCTAGCCTTAGCGCCCGTGGATTGAGTTCTGTANCCTCTCTCCCCNACTTCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI10517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73610025..73610485 431
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST15000C2HMF1
Sequence
GTTTCAGGTGTTCAAGACAGTACCAGTGTGGCACTGCTGCCTGCGGATCAGGGTAGAGAACTCTCAGTTCCTTCTCCAGC
ACCATGTCTGCCTGCTTCCTGCCGTGAGGATAACGCACTGAACCTCCAGGAACTGTAAGCCAGCCCCAATTAAATGTTGT
CCTTTATGAGAACTGCCATGGTGCTGTTCANCAATAGAAACCCTAAGACAAGCAGGGATCGTGTTCCTGTCTCNTAACTT
ACTNNNCAATANATCNNAACTGTCTCACTCGATGGGAAAGANAANAAAACATANCTTCAATTTAAAANNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73610482..73610788 285
 
EST/CDNA Est Name
  CJ137677.1 - BI652312.1

 
Come back to gene CJ137677.1 - BI652312.1


For any suggestions or comments, please send an email to unitrap@crg.es