Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14687A1
Clone ID IST14687A1
Vector VICTR76
Project tigm

Sequence tag IST14687A1HMF2
Sequence
CAGACCAGTTTAGTCCTAAGTGTTGCCGCTCTCCTGGGCCTCTTGTAAGCTTTGGGAAGTGAGGAGGTGAGAGTGGGGCT
GGGCCTTTAGCTTTTGGCATATTACTGAGGATGGCCTTCTCCAGGCAGGGGCCTCTCTCCCTGAC
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71612939..71613082 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]


Sequence tag IST14687A1HMR1
Sequence
TCTGGANCCACCTTAACAAAAATACCCAAGTCCTAACCCCAAAACAAGGGAGCTCTTAAGTTTGGTCNATGCTACCCAAG
CAAACTATCCCCCCACCCTAATGCATTTACTTTATTTTACATGTATGAGTACTTAACCTCATGTATGTCTGTGTAACACG
TGTGCTCCTGTTACCCTTGGATGTTAGAAGAGGGCATTGGATCACCTGGAACTGCAGTTATGGATGGCTGTGANCTGAAC
TTGGGTCCTCTGCAAGGGTTTTTCATGTTCTTAACCNCTGANCNNTCTCTCCNNCCCANTTCCTCTAACTAACTNACTCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71613079..71613426 322
 
EST/CDNA Est Name
  CJ116891.1 - BE989168.1 - CJ122211.1 - CJ116226.1 - BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213.1 - CJ077707.1


Sequence tag IST14687A1BBF1
Sequence
GTCTAGATCAGATGTTTTTGTGGGGCTCACACAATGTATTAAGAGGAGTGAGATTAAGCCTCTCGAAAAACCAAAAAAAA
AAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72490223..72490304 80
NO GENE  

 
Come back to gene CJ116891.1 - BE989168.1 - CJ122211.1 - CJ116226.1 - BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213.1 - CJ077707.1


For any suggestions or comments, please send an email to unitrap@crg.es