Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12339A4
Clone ID IST12339A4
Vector VICTR76
Project tigm

Sequence tag IST12339A4HMF2
Sequence
CCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGC
TGCTGTGGCTTANGCCGCCTCCCCTGCCGGGTGGGCACCTGTCCTCCGGTCCNGAANGTGGCCGGCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI31227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 27826452..27826601 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60113400..60113549 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82116073..82116222 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70947029..70947178 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22619803..22619952 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84628966..84629115 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14462450..14462599 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54200859..54201008 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020332 (4930404A10Rik) NP_083381 RIKEN cDNA 4930404A10 gene Gene [Source:MGI Symbol;Acc:MGI:1922097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82369444..82369593 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521367..35521516 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57052671..57052820 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59583127..59583276 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7437285..7437434 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21861235..21861384 144
 
EST/CDNA Est Name
  BX512183.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 56650600..56650749 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55880206..55880355 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66036138..66036287 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 41032266..41032415 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46152249..46152398 144
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324694..7324843 144
NO GENE  


Sequence tag IST12339A4BBF1
Sequence
CCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGC
TGCTGTGGCTTAGGCCGCCTCCCCTGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCAC
ACAGGGTGCTGCCTCANCGCCTCTGTGCTTCTGCCTGTTCCANAAGCTGTCANGTTCTCTGGCGCACCCTCTCACCTGTT
CANACTAATTTCCTAANTTCGGCGGGTCTCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTANGCCGCCTCCCNNNCC
GGACNGNCACCTGTCCTCNNGTCCNGANNGNGGCNGGCNNNNNNCNGCCNGCACANGGTGCTGCNNNNNNCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BX512183.1


For any suggestions or comments, please send an email to unitrap@crg.es