Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12525A6
Clone ID IST12525A6
Vector VICTR76
Project tigm

Sequence tag IST12525A6BBF1
Sequence
AGGTNAGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32142 UNI32143 UNI32144 UNI32145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317897..317958 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12013086..12013147 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046139 (Patl1) NM_172635 protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9952580..9952641 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6412205..6412266 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15628078..15628139 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34209161..34209222 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62571799..62571860 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37788862..37788923 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53117238..53117299 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98878953..98879014 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56419813..56419874 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81528389..81528450 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 31909562..31909623 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54844659..54844720 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4925448..4925509 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 49308843..49308904 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32834196..32834257 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058006 (Mdn1) NP_001074861 midasin homolog (yeast) Gene [Source:MGI (curated);Acc:Mdn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21748622..21748683 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53991780..53991841 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023092 (Fhl1) NM_001077361 four and a half LIM domains 1 Gene [Source:MGI (curated);Acc:Fhl1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25197579..25197640 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036646 (Man1b1) NM_001029983 mannosidase, alpha, class 1B, member 1 Gene [Source:MGI (curated);Acc:Man1b1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63393043..63393104 60
NO GENE  

 
Come back to gene ENSMUSG00000036646


For any suggestions or comments, please send an email to unitrap@crg.es