Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P067A05
Clone ID P067A05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P067A05
Sequence
TGTCTTTTTGTGCCGAACATGCTCGAAGAAATGCCCTAGCACTTCATGCTCAAATGAAGAAGAGCAACCCAGGCCCTATG
GGTGAAACCCTCTTGTGCCAGTTGAGCTCATACGCTAAAACAGAGCTGGGCTCGCAGACCCCAGAGAGCAGCCGCAGTGA
AGCCAGCCGGATACTGG
Sequence Type mRNA
Unitrap ID UNI11435 UNI11569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98362151..98362327 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022992 (2310037I24Rik) NM_133714 RIKEN cDNA 2310037I24 gene Gene [Source:MGI Symbol;Acc:MGI:1916862]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 79817957..79818133 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070035 (AC136516.3) CL041_MOUSE Isoform 2 of Q8BQR4 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q8BQR4-2]

 
Come back to gene ENSMUSG00000070035


For any suggestions or comments, please send an email to unitrap@crg.es