Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12570G10
Clone ID IST12570G10
Vector VICTR76
Project tigm

Sequence tag IST12570G10BBF1
Sequence
CCACATGGTGGCTCACAACCACCCAAAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI10004 UNI32147 UNI32148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41487379..41487415 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 75328190..75328226 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85472870..85472906 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37828708..37828744 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 92003155..92003191 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53080976..53081012 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58423144..58423180 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 74615937..74615973 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009681 (Bcr) NM_001081412 breakpoint cluster region Gene [Source:MGI Symbol;Acc:MGI:88141]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 110033019..110033055 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35321204..35321240 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11638427..11638463 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 68472918..68472954 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028351 (Dbc1) NM_019967 deleted in bladder cancer 1 (human) Gene [Source:MGI (curated);Acc:Dbc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76887521..76887557 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166807196..166807232 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121767722..121767758 37
NO GENE  

 
Come back to gene ENSMUSG00000028351


For any suggestions or comments, please send an email to unitrap@crg.es