Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0027
Clone ID CC0027
Vector pGT0lxfT2
Project sanger

Sequence tag CC0027
Sequence
AGGCAGNTGGGTGCCATCTCCCAGGGGATGTCAGTCCAGCTTCGTGTGCCTCACTCAGAGCATGCCAAGGCCCCCATGGG
CCCTCTCACCATGGGGCTGCCCCTTGCCGTGGACCCTAAGAAGCTGGCCCCCTTCAGTGGAGTGAAGCAGGAACAGTTGT
CCCCTCGGGGTCAGGCTGGGCCACCTGAAAGTCTGGGAGTGCCCACTGCTCAGGAGACCTCTGTGCTGAGAGGGACAGCA
CTGGGCTCCGCCACCAGTGGAAGCATCACCAAGGGCCTCCCCAGTACCCGGGCTGCAGACGGCCCCAGCTACAGAGGCTC
TATCACCCAC
Sequence Type mRNA
Unitrap ID UNI1593

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125517191..125518254 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es