Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P066E03
Clone ID P066E03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P066E03
Sequence
TCCTCCTCTCATCATGGTTACCACCAAAATGACTGCTGCCTTTAGAAACCCTAATAGGAGACAGGTCCCAGAAGGCCCAG
ACGGAGGATGCTGGGAGCAAGCCAGAGGAGCTGCATCAGAGAGTCCTGGGTTCAGTTAATTAGGAGGAGGGTGGTTGAGG
GGGCCTCCCAGTCTCAGGCCTCCATGTGCATCCACACATGTGCACGGTCGGGTGTGAACAGGCATCCACATAGGCACACA
GACTGCATGGACAGACACGTGCACAAACAATGTCTAAAGTCTGTAGCTACAACTCATCTCTGTACATTCATAGCAGTCTA
GTGGCTACCTCCACAAGAAATTGCAAGCATATGCTCTGTGAAGCAATGTTCTTTCCTAAGGCGATGCTCGGTGTCTCCAG
NNCAGNNGATCATGGGAAGTAAAAGTCGGAGGCCGAATACGCCACCCAGAGTTCCCAG
Sequence Type mRNA
Unitrap ID UNI11573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108301649..108304071 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es