Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14210H5
Clone ID IST14210H5
Vector VICTR74
Project tigm

Sequence tag IST14210H5HMR1
Sequence
NGGTATTATAGGGGTATGCTTTTTTTTTGGGGGGGGGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84839935..84839971 37
NO GENE  


Sequence tag IST14210H5HMF1
Sequence
ACCAGCACTCAGGATGCTGAGGTGGGAGGATGCCAAGTATAAGATCTTTTTGAGGGCTACATAACAAGTTTGAGGCTCAC
TTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84839969..84840055 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14210H5BBF1
Sequence
ACCNGCACTCAGGATGCTGAGGTGGGAGGATGCCAAGTATAANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es