Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P066E10
Clone ID P066E10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P066E10
Sequence
GGGGGTTCAATATGGCGGCGCCCAGTGGCAGTGTGAACTGTGAAGAGTTCGCCGAGTTCCAG
Sequence Type mRNA
Unitrap ID UNI10857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072166..36072223 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es