Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P066C05
Clone ID P066C05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P066C05
Sequence
GTAACAAAAAGGCCCCATACCCCAACACCAGGAATTTATATGGGGAGACCCACTTA
Sequence Type mRNA
Unitrap ID UNI11574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22250938..22250992 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es