Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14479B11
Clone ID IST14479B11
Vector VICTR74
Project tigm

Sequence tag IST14479B11HMR1
Sequence
ATGTGGTTGCTGGGATTTGAACTTCGGACCTTTGGAAGAGCAGTCAGGTGCTCTTACCCACTGAGCCNTCTCACCAGCCC
ACACACTTAGAATTCTAACCCAGGTANCGTTCTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108173419..108173550 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


Sequence tag IST14479B11HMF2
Sequence
ACATGATGGCTCACAACCATCCATAATGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTATTTACA
TATAATAAAAATAAATAAATCCTAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108173308..108173422 115
NO GENE  


Sequence tag IST14479B11BBF1
Sequence
ACATGATGGCTCACAACCATCCATAATGAGATCTGTCGA
Sequence Type genomic DNA
Unitrap ID UNI2280 UNI5844 UNI30597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 30373895..30373932 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17080277..17080314 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85332404..85332441 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51441946..51441983 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001054 (Rmnd5b) NM_025346 required for meiotic nuclear division 5 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rmnd5b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119007997..119008034 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 117393005..117393042 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 48458456..48458493 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48701380..48701417 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043505 (Gimap5) NM_175035 GTPase, IMAP family member 5 Gene [Source:MGI (curated);Acc:Gimap5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 39036221..39036258 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 53835324..53835361 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95152440..95152477 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015697 (Setdb1) NM_018877 SET domain, bifurcated 1 Gene [Source:MGI (curated);Acc:Setdb1-005]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 148671061..148671098 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18578426..18578463 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107390108..107390145 36
NO GENE  

 
Come back to gene ENSMUSG00000015697


For any suggestions or comments, please send an email to unitrap@crg.es