Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12351B2
Clone ID IST12351B2
Vector VICTR76
Project tigm

Sequence tag IST12351B2BBF1
Sequence
AACCCAGTGTGTCTTTCANCTGCTGCTGTATGTGTGCTAGGCTGGCTGGGGGCTGGGCTGGGGGTTGGGCAGGTAATACA
AAGCCCTGATCTTANCATGTGAACAAGGCTCTGCCAGGCANCGCANGTCTGGAGTGAGCCACACTGGACTACTTGGCTCT
AATCTGTGCTCAATGGAACACCCTCTTCTGTATGGTCTACTTGGGCATGGGTCAGGGGAAAGCCCCCATTCTTCCATTCC
CTCCANTCACCCCTTCTCTTTCCCAACACCATTTTTGAGGATCATAACATTTATCACGAGCATTATTATGAGAGACTTTT
TCNTGTTTAAAAATAAATGCTNNCTTAAAGGACTATATTTGGTATATGGAANTCGTTTGCATGTNAATGTGCTTAAAGGA
CAACACTTTGCTTAAGATGGAGAGGGAGCCCTGACTAGAGGGCGCANGAGTGGGTGGGGAANANGTTCAGGGTCTGCCTG
CTTGGGACACTTGACTTGGAGCCTTAN
Sequence Type genomic DNA
Unitrap ID UNI15948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106649328..106649833 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]


Sequence tag IST12351B2HMF1
Sequence
AACCCAGTGTGTCTTTCACCTGCTGCTGTATGTGTGCTAGGCTGGCTGGGGGCTGGGCTGGGGGTTGGGCAGGTAATACA
AAGCCCTGATCTTAGCATGTGAACAAGGCTCTGCCAGGCANCGCAGGTCTGGAGTGAGCCACACTGGACTACTTGGCTCT
AATCTGTGCTCAATGGAACACCCTCTTCTGTATGGTCTACTTGGGCATGGGTCANGGGAAAGCCCCCATTCTTCCATTCC
CTCCANTCACCCCTTCTCTTTCCCAACACCATTTTTGAGGATCATAACATTTATCACGAGCATTATTATGANANACTTTT
TCATGTTTAAAAATAAATGCTANCTTANAGGACTATATTTGGTATATGGAANTCNTTTGCATGTAAATGTGCTTAAANGA
CAACACTNTGCTTAANATGNANANGGANCCCTGACTAGAGGGCNCANNANTGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es