Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12767D9
Clone ID IST12767D9
Vector VICTR76
Project tigm

Sequence tag IST12767D9BBF1
Sequence
GTTGTAATGCTCAGGAGTGGTGGAAGGGAGACTTGAGAGACATGTTGGGGTACCCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27204298..27204358 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]


Sequence tag IST12767D9HMF1
Sequence
CTCTGAAGCAAGACCATACTCAATCACAAACGGTCTGAAAGTACATCTGAAACAATCAGGCTAATCTTTGATTAACTGCT
GCTAGGAAGTANCTAGGGAGTAACTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130993867..130993975 107
NO GENE  

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es