Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0016
Clone ID CC0016
Vector pGT0lxfT2
Project sanger

Sequence tag CC0016
Sequence
TGGGAAATGTGTGCTTGCGCGGTTGCTGGAGTCGCGGTCTCTTCCCTGGTGGTTCCGACTGCGGAGAGCGGGGAGATGAA
GACGAAGGCCACCGCGCCGGTGCCCCAACCTGGGCCTATCAGGAAGCTCGCTAGGAAGAAAGCCAAGAAGAAGTTCAGGA
AGAGCAAAGCTCTGGCAGGAAGTGGGGTTCCGGGAAGCCACCCGGCGGCTGTGGCAGGCCGACCGCCGAAGGCCCCCGAG
AACTTTTCTCAAAATTGGAAGGCGTTGCAAGAG
Sequence Type mRNA
Unitrap ID UNI1596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26819572..26819844 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052406 (Rexo4) NM_207234 REX4, RNA exonuclease 4 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rexo4-001]

 
Come back to gene ENSMUSG00000052406


For any suggestions or comments, please send an email to unitrap@crg.es