Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P065G07
Clone ID P065G07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P065G07
Sequence
TTGAAACTTTTAAAAGCTCTGTGCTCCAAGTTAAAAAACGCTTTTACGAGGTATCAGCACTTTTCTTTCATTGGGGGAAA
GGCGTGAGGGAAGTACCCAACAGCAGCAGACTTTGAAACTTTAAACAGACAGGTCTGAGAGCCCGAACTCTCCTTTTCCT
TTGACTTCAGCCTCCAAGGAGTTCCACCACTTTGGCGTGCCGGCTTCACTTTCATTAAGTGAAAGA
Sequence Type mRNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56097099..56097324 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es