Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P065F09
Clone ID P065F09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P065F09
Sequence
GAGGTTCCTGGGCTAGCACGTGGGGGAGCGGCCGAAGCGCCGTGCAGCGCTGCGGGGCAGGGCCGCTGGACTAGGTGGGG
GGCCAGGGGGCGGTGGCGGGAGGATTGAGTGCCTAGACGGTCGCCCAGGAGCAG
Sequence Type mRNA
Unitrap ID UNI10502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88725711..88725838 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es