Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0006
Clone ID CC0006
Vector pGT0lxfT2
Project sanger

Sequence tag CC0006
Sequence
GATCAGTGAAAGAGACCATGAGGAAGAGGATGTCTAAAAAGTACAGCAGCCCGGTCTCTGAGCACGACTTGGGGCACGAA
GGAATTTCCAGCTCTTCCATCTCAGGAAAGCCTGACTCCGAACACGTGGACAAGCATAAGCTCAAAGCCGGGGGTTCTGT
GGAAAGCCTTCGGAGTTCTCTGAGTGGCCAGAGCTCAATGAGTGGTCAGACAGTGAGCACCACTGATTCCTCCACCAGCA
ACCGGGAGAGTGTCAAGTCAGAAGATGGGGATGACGAAGAGCCACCCTATCGGGGTCCCTTCTGTGGGCGTGCCCGAGTG
CACACTGACTTCACCCCCAGTCCCTATGACACGGACTCTCTGAAGCTCAAG
Sequence Type mRNA
Unitrap ID UNI1599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8461226..8464350 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015305 (Sash1) NM_175155 SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

 
Come back to gene ENSMUSG00000015305


For any suggestions or comments, please send an email to unitrap@crg.es