Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0005
Clone ID CC0005
Vector pGT0lxfT2
Project sanger

Sequence tag CC0005
Sequence
CTTGTTGAACTAATGGAGCGAACTGAGATGCCGTGCCAGGCATTGGTGAAGATGCTAGCAAAAAAACCTGGATGGAAAGA
AACTAATTTTCAG
Sequence Type mRNA
Unitrap ID UNI1600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91410339..91410429 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es