Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14221H6
Clone ID IST14221H6
Vector VICTR74
Project tigm

Sequence tag IST14221H6BBF1
Sequence
CCTCCATGAATCTTTTTTTTTCTTTTTGANACAGGGTCTCATTATGTAGCCGGGCTATCCTAAAATTTATTATGTAGCCC
AGGCANACCTCCGACTTGCTCCTGCCTCTGCCTCCCAAGTGCTGGGATTACAAGGTGTATAAAACCACGCCTAACCACAA
CTTCCCCATTTTGATAACCATANATGCTTTGGATCAAGGGCCTTCCAACTAATCCAGTGTTGAAACATATTAAAACACAT
AACCTTTCTACAANACAGTGCCACATCCCAGGAAACATATCCNCCCAGCTTGTATATGCTCAATACANAAAACTTTTCCT
CTTCCGCACCANNNTTTTTTATTTTTTATTTTTGGTGAGCGTCAGGGTTTCACCATGTANCTCTAGATGCCNGGGANNAA
CAAATGTANACNANGCTGGCTTTGAACTCANANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14221H6HMR1
Sequence
NNNNAACATCTTTTACGTAACANAAACATCGTTGGGAACTGTTAGTTGAGCCGTTCACCAAGAACAAACAGAATATTATC
GCTGATGGCTGGAAATCTTTTCAAATATGTTGTACAGGTAGCCCGCATGGTGGATCTGCCGGCCAACAAGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216152..40216301 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]


Sequence tag IST14221H6HMF2
Sequence
AAGTCAAGCATAAACATATGAAGGTCTATCCGCATTTGGTGGAAACCGATGTGGGTGTGGGACGGCAACTTTGATTCTTC
CACCGTGGACTATTTTCCAATAAACTTTTATATGCACACGATGGCACACTATCTTGTATTAATACCGCACTGCAAATGCA
GGATAAAGCAGTTAAGGAATTCCTATGTGAGCGCAAAAAAGGCGCGATCTTCACATTTTCTCTTTTATTCCCTCTGCTGC
CTGAAAGGCGGGCTAGGCCCGGATCACGTGATGTGTTCCAACTCCGGGCGGAAGCCCGCGGGAGCGCGCAGAGTCCCGCT
GAAAAATGGCTGCTGCATCGGGGTGCAATGCGCCCGCGAGCAGGCTGTANGGCCCTTGCCNCCCCGTCCCCGCTGCTCCC
TTACCATGANGCCGATGANTCNCCNAANCCTGGACTGNNCTTACTCCCTGGTANGTN
Sequence Type genomic DNA
Unitrap ID UNI13990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216303..40216758 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028407 (2010003O02Rik) RIKEN cDNA 2010003O02 gene Gene [Source:MGI Symbol;Acc:MGI:1913684]

 
Come back to gene ENSMUSG00000028407


For any suggestions or comments, please send an email to unitrap@crg.es