Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14390H10
Clone ID IST14390H10
Vector VICTR74
Project tigm

Sequence tag IST14390H10HMF1
Sequence
ATGTGTACGCAAGGAGAAAGAAATGCAGAGACAGAAAAAGAGACAGAGGAGGGGAACGAGGACAAAATGTCTGGATTATA
TAGGTAAGAGCCTTTGGGGGAGGGGAAGCCCAGTTCTGGTATGCCAGCTATATCCTGCAAGAGGTGTGGGCTAAGGGATG
CTCGGGGAATCTGGAGGCCAGGTCTGCTTTGATGCGTTACATATGCACCTCTGCCGCTCGTCTGAAACCCAACAACAGGG
GCAGAGGACAAATACAGGAAGTCGTAAATTAAATGCCTTTGTTTTCAAGTTAATGGCAAAGCTAAGTAATAGCTCGGCAC
AAGTGTTAAGCATGCTTGGATCCCTAACCGCCTGANGCCTCCCAGCAAGTGTCCAGANGTGCCTAACCGANGCCTCTGGG
ATCGGTGTANCAGTGGGCGGTAACCGGCTGGANAAAANGCNNNTGAGCCCCAAAACCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI31817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107455938..107456398 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]


Sequence tag IST14390H10BBF1
Sequence
ATGTGTACGCAAGGAGAAAGAAATGCAGAGACAGAAAAAGAGACAGAGGAGGGGAACGAGGACAAAATGTCTGGATTATA
TAGGTAAGAGCCTTTGGGGGAGGGGAAGCCCAGTTCTGGTATGCCAGCTATATCCTGCAAGAGGTGTGGGCTAAGGGATG
CTCGGGGAATCTGGAGGCCAGGTCTGCTTTGATGCGTTACATATGCACCTCTGCCGCTCGTCTGAAACCCAACAACAGGG
GCAGAGGACAAATACAGGAAGTCGTAAATTAAATGCCTTTGTTTTCAAGTTAATGGCAAAGCTAAGTAATAGCTCGGCAC
AAGTGTTAAGCATGCTTGGNNCT
Sequence Type genomic DNA
Unitrap ID UNI31817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107455938..107456276 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]

 
Come back to gene ENSMUSG00000010067


For any suggestions or comments, please send an email to unitrap@crg.es